Table 1.

Primer sequences for RT-PCR

5-HT2A receptor Sequence Position Length of fragment
Primer 1
    Sense 5′ AGC CGCTTCAACTCCAGA A 609-627 410
    Antisense 5′ TTTTGCTCATTGCTGATGGA 1018-999
Primer 2
    Sense 5′ TGTGCGATCTGGATTTAACTGG 501-522 571
    Antisense 5′ GGCACCACATTACAACAAACAGG 1071-1049
5-HT7 receptor
Primer 1
    Sense 5′ TTACCTCCTCTCTTCGGATG 767-786 660
    Antisense 5′ GTCTTACAGCACAAACTCGG 1426-1407