Table 2.

Oligonucleotide primers used for cDNA amplification

Sense primer Antisense primer
mRNA 5′ 3′ 5′ 3′ Anneal temperature PCR target Cycles
IL-1β GCACCTTCTTTTCCTTCATC CTGATGTACCAGTTGGGGAA 55°C 448 bp 40
TNF-α GGCAGGTCTACTTTGGAGTCATTGC ACATTCGGGGATCCAGTGAGTTCCG 56°C 319 bp 40