Table 1.

Primers used for quantitative real-time PCR

Mus gene Accession number Forward primer (5′-3′) Reverse primer (5′-3′)
CD80 AF065894 CCCCAGAAGACCCTCCTGAT CTGCCCCAAAGAGCACAAGT
CD86 NM_019388 CCTCCTTGTGATGCTGCTCA GGCTGATTCGGCTTCTTGTG
CCL5 NM_013653 TGCTCCAATCTTGCAGTCGT ACACACTTGGCGGTTCCTTC
CXCL10 NM_021274 GGGCCAGTGAGAATGAGGG GCTCGCAGGGATGATTTCAA
CCL2 NM_010778 TTCAGTCTGGTAACATGACGGC GGTGCGTTGAGTCTGGCATAA
IGF-1 NM_010512 CCTCAGACAGGCATTGTGGA CCTCAGATCACAGCTCCGGA
TGF-β1 NM_011577 TGGAGCTGGTGAAACGGAAG ACAGGATCTGGCCACGGAT
IL-1ra NM_031167 CGCTTTACCTTCATCCGCTC TGACTCAAAGCTGGTGGTGG
  • Accession numbers are from GenBank.