Table 1.

Primer sequences used to amplify mRNA

GeneForwardReverse
RoraTCCAAATCCCACCTGGAAACGAAGGTCTGCCACGTTATCTG
ArbpTGCCAGCTCAGAACACTGGTCTAGGGAGATGTTCAGCATGTTCAGCA
Hif1aCGGCGAAGCAAAGAGTCTGATAGACCACCGGCATCCAGAA
VegfTGACTGCTGTGGACTTGTGTGAATGGGTTTGTCGTGTTTC
Sod1TGGGTTCCACGTCCATCAGTAACCGTCCTTTCCAGCAGTCA
Gpx1GGGACTACACCGAGATGAACGAACCATTCACTTCGCACTTCTCA
Prdx6TGCTGGGAATAGCATGGGTAAACCTCTGAGAAGGTGCACA
CatGCGTCCAGTGCGCTGTAGATCAGGGTGGACGTCAGTGAA
RorbTGTGTCGTGCCTTCAACCCATTTCTCTTCCTCAGTCAGCTGCAA
Nip3CCTGTCGCAGTTGGGTTCGGTCGTCCAGATTCATGCTGGGCA
Hk2AGCTGGTGAGCCATCGTGGTATCTTGTTGCGGCGAGTCGG