Table 1.

Primers for Single-cell PCR

GenePrimerPositionSequenceProduct size (bp)Reference
Corticotropin-releasing hormoneCRHF (outside)GGGGAAAGGCAAAGAAAAGG140 bpHoyda et al., 2009
R (outside)GACAGAGCCACCAGCAGCAT
F (nested)GGAGAAGAGAAAGGAGAAGAGGAA
R (nested)GGACACCAGCAGCCGCAG
GABAA receptor δ subunitGabrdF (outside)GACTGCTGCAAAGGCTGCCGGGAAC258 bpBrowne et al., 2001
R (outside)ACCACTGTGCTAACCATGACCACAC
F (nested)TTGAGTCTGGAACGGATGCCTC
R (nested)CCCACTTCAATGCTGACTACAGG
OxytocinOTF (outside)CTGCCCCAGTCTCGCTTG244 bpHoyda et al., 2009
R (outside)CCTCCGCTTCCGCAAGGCTTCTGGC
F (nested)CTGCCCAGTCTCGCTTG
R (nested)GCGAGGGCAGGTAGTTCTCC
Thyrotropin-releasing hormoneTRHF (outside)AGAGGGGAGACTTGGGAGAA245 bpHoyda et al., 2009
R (outside)CTTTGCTTCACCAGGGTCTC
F (nested)ATTCATGGGCAGATGAGGAG
R (nested)GGCGTTTCTCAGGCATTAAG
  • F, Forward; R, reverse.