Table 2.

qPCR primer sequences

PrimersForwardReverse
RALDH2TTTTGCTGATGCTGACTTGGGCAGCACTGACCTTGATTGA
FOXP1TGACCTTTTGAGGTGACTATAACTGTGGCTGAACCGTTACTTTTTG
LHX3GTTCAGGAGGGGCAGGACCCCAAGCTCCCGTAGAGG
CHT1AAGCCATCATAGTTGGTGGCCGAGCCAAGCTAGGCCATAACCTGGTAC
HOXA5CAGCACCCACATCACGGAGAGGCAAAGA
HOXC6CCAGGACCAGAAAGCCAGTAGTTAGGTAGCGATTGAAGTGAAA
HOXC8CTTCGCTGTTTGATTTCTATTCTGTACGCTGGAGGTTTCTTTCTTT
HOXD9TCGCTGAAGGAGGAGGAGACAAACACCCACAAAGGAAAAC
  • STD qPCR amplification: 95°-30″, 55°-60″, 72°-45″.