Table 1.

Primer list for single-cell RT-PCR

MarkerGenBank Accession numberFirst PCR primersSize (bp)Second PCR primersSize (bp)
GAD65NM_08078.2Sense, 99: CCAAAAGTTCACGGGCGGa375Sense, 219: CACCTGCGACCAAAAACCCT248
Antisense, 454: TCCTCCAGATTTTGCGGTTGaAntisense, 447: GATTTTGCGGTTGGTCTGCC
GAD67NM_008077.4Sense, 83: ATGATACTTGGTGTGGCGTAGCa253Sense, 159: CAATAGCCTGGAAGAGAAGAGTCG177177
Antisense, 314: GTTTGCTCCTCCCCGTTCTTAGaAntisense, 314: GTTTGCTCCTCCCCGTTCTTAG
PVNM_013645.3Sense, 67: GATAGGAGCCTTTGCTGCTG281Sense, 124: GGGCCTGAAGAAAAAGAACC224
Antisense, 347: CAGCCACCAGAGTGGAGAATAntisense, same as the first PCR
SAP97NM_007862.3Sense, 481: AAGGCAAATCCTCCTCCAGT964Sense, same as the first PCR239
Antisense, 1445: ACCGATATGATGCGATCTCCAntisense, 719: TTTACCCGCAATCTTCCATC
3′ UTRNM_007862.3Sense, GGTTTGGCCAGTGTATTAGCTCSense, GTCCTCCACACTGACACAGATC380
Antisense, GAGCTAATACACTGGCCAAACCAntisense, CAGAGCCGTAACCACAGTGTAC
VGlut1NM_182993.2Sense, 124: CCCTTAGAACGGAGTCGGCTb593Sense, 148: ACGACAGCCTTTTGCGGTTCb367
Antisense, 697: TATCCGACCACCAGCAGCAGbAntisense, 495: CAAAGTAGGCGGGCTGAGAGb
  • Position 1 is the first base of the start codon. The SAP97 primers are pan-SAP97 recognizing both the α and β isoforms.

  • aKaragiannis et al., 2009.

  • bVullhorst et al., 2009.