Table 1.

Primer sequences used in the study

ConstructPrimer sequence
R204S
    ForwardCATGTTTATCGACAGCCACAAACAG
    ReverseGCTGTTTGTGGCTGTCGATAAACAT
H205N
    ForwardGTTTATCGACCGCAACAAACAGCTG
    ReverseCAGCTGTTTGTTGCGGTCGATAAAC
K206N
    ForwardGACCGCCACAATCAGCTGC
    ReverseGCAGCTGATTGTGGCGGTC
R204S + H205N + K206N
    ForwardAGCAACAATCAGCTGCGGG
    ReverseCCCGCAGCTGATTGTTGCT
GluA1(D586N)
    ForwardCAGCAAGGATGTAACATTTCCCCCAG
    ReverseCTGGGGGAAATGTTACATCCTTGCTG
GluA1(D586K)
    ForwardpATTTCCCCCAGGTCCC
    ReversepTTTACATCCCTGCTGCA
ΔC terminusGTTTATCGACCGCCACTAACAGCTGCGGGCC
γ-2(1–228)
    ForwardCATCCCCAGCTAGCGCTACCG
    ReverseCGGTAGCGCTAGCTGGGGATG
γ-2/6
    γ-2 ForwardGCACATGTTTATCGCGAACCGCCACAAACAGC
    γ-2 ReverseGCTGTTTGTGGCGGTTCGCGATAAACATGTGC
    γ-6 ForwardCACTGCCTTCCTGGCCCTGGG
    γ-6 ReverseGGCGGATCCGAGTCGAGCTAG
    Final mutagenesisGTGCACATGTTTATCACACTGCCTTCCTGG
GluA1 tandems
    ForwardTTTTTGCTAGCATGCCGTACATCTTTGCC
    ReverseTTTTGAATTCTCCTCCTCCTCCTCCAATTTTAACACTCTCGATG