Table 2.

Primer/probe sequences for FACS-isolated neurons

GeneTaqMan probe or primer/probeForward primerReverse primer
Pde10aTCCCATCGAGACCGCCGCTGAACCTCCACAACCACGCAGGCAGTCATCATCAAG
NeuNCACTCCAACAGCGTGACGGCCCCTGGCAGAAAGTAGTTCCCCCTGGTCCTTCTGA
GapdhCTCATGACCACAGTCCAGACAACTTTGGCATCGTGGAACACAGTCTTCTGAGTGGCAGTGA
ActbATGAAGATCAAGATCATTGCTAGAAGGAGATTACTGCCCTGCCACCAATCCACACAGAGTACTT
FosRn00487426_g1a
Erg1Rn00561138_m1a
ArcRn00571208_g1a
BdnfTGGTCAGTGGCTGGCGGAGACCCTCCGCAACTGTGAGCTATGATGTATCTTAGTGGGTATGAG
Trkb1CATGAAAGGCCCAGCTTTGGCGAGACATTCCAAGTTTGAGAGTCATCGTCGTTGCTGATG
Gria1Rn00709588_m1a
Gria2Rn00568514_m1a
Gria3Rn00583547_m1a
Grin1Rn01436038_m1a
Grin2aRn00561341_m1a
Grin2bRn00680474_m1a
Grm1Rn01440619_m1a
Grm5Rn00690337_m1a
Hdac1Rn01519308_g1a
Hdac2Rn01193634_g1a
Hdac3Rn00584926_m1a
Hdac4Rn01427040_m1a
Hdac5Rn01464245_m1a
Sirt1CAGTGTCATGGTTCCTTTTGCAGGAATCCAAAGGATCACAAATCAGGCAAGATGCTGTTG
Sirt2Rn01457502_m1a
CrebbpRn01427040_m1a
Suv39h1Rn01528294_g1a
Ehmt1 (GLP)Rn01435512_m1a
Ehmt2 (G9a)Rn0152918_m1a
Kdm1aRn01181029_m1a
Kmt2a (Mll1)CAAACAGACTGACCAGCCGCCCAGCTCTGCAAGATAGAGAATCACTTTCTTGACCCTGTGCTTT
Dnmt3aRn01027162_g1a
  • aTaqMan catalog number.