Table 1.

Primers used for both steps of nested PCR, including sequences, target locations, and amplicon sizes

GeneGenBank accession numberFirst PCR primersSize (bp)Second nested PCR primersSize (bp)
GAPDHNM_017008.4Sense, 373: TTCACCACCATGGAGAAGGC321Sense, 468: GGGTGTGAACCACGAGAAATA104
Antisense, 693: AGGGATGATGTTCTGGGCTGAntisense, 571: AGTTGTCATGGATGACCTTGG
HPRTNM_012583.2Sense, 514: GTCAAGCAGTACAGCCCCAA256Sense, 567: GACCTCTCGAAGTGTTGGATAC107
Antisense, 769: TGGCCACATCAACAGGACTCAntisense, 673: TCAAATCCCTGAAGTGCTCAT
mGluR1 (pan)NM_017011.1Sense, 1652: AACATGCACCATGCTCTGTG205Sense, 1682: GTGGGCCTGTGTGATGCTAT93
Antisense, 1856: AGTCATAGCGATTAGCTTCTGTGAntisense, 1774: CTCCTCTCCAGACACTCCGA
mGluR1a-1NM_017011.1Sense, 2934: CTGATGTTGTCCGCATGCAC210Sense, 2934: CTGATGTTGTCCGCATGCAC113
Antisense, 3143: CCGTCTCGTTGGTCTTCACGAntisense, 3046: GCCGTTAGAATTGGCATTCCC
mGluR1a-2NM_017011.1Sense, 2934: CTGATGTTGTCCGCATGCAC210Sense, 3026: GGGAATGCCAATTCTAACGGC118
Antisense, 3143: CCGTCTCGTTGGTCTTCACGAntisense, 3143: CCGTCTCGTTGGTCTTCACG
mGluR1a-3NM_017011.1Sense, 5662: TCTCTTCCTTATGATCCTCATGTGT276Sense, 5843: TGTGAGATGAACCCGTTCCC91
Antisense, 5937: AGAAACCAGCAGCTTCGACAAntisense, 5933: ACCAGCAGCTTCGACATGAA
mGluR1a-4NM_017011.1Sense, 5662: TCTCTTCCTTATGATCCTCATGTGT276Sense, 5781: TGACCCTACCTTTTCGAACCC92
Antisense, 5937: AGAAACCAGCAGCTTCGACAAntisense, 5872: ACCCGTTCCCTTTAAATAAT
mGluR5NM_017012.1Sense, 2711: GCATGTTTGTCCCGAAGGTG231Sense, 2797: ATGCATGTAGGAGACGGCAA110
Antisense, 2941: CCAGAATGAGAAGAGTACCCAntisense, 2906: TTTCCGTTGGAGCTTAGGGT
ERBB4NM_021687.1Sense, 682: TGTGATGGCAGGTGCTATGG368Sense, 717: CTGCTGCCATCGAGAATGTG120
Antisense, 1049: GTGCCGATTCCATCACATGCAntisense, 836: GTGCCGATTCCATCACATGC
vGATAF030253.1Sense, 1783: ACCTCCGGTTCCTAGTTGCT337Sense, 1888: ACATCGTCCTGATTTGGGGG117
Antisense, 2119: TGGCTGGACGCAGTAGATTCAntisense, 2004: ACCCCTAACATTGACTGGAGC
GAD65NM_012563.1Sense, 771: GGCTCTGGCGATGGAATCTT306Sense, 798: GGTGGTGCCATCTCCAACAT116
Antisense, 1076: GGCACTCACCAGGAAAGGAAAntisense, 913: TGCTCTGACGTGAATGCGAT
GFAPNM_017009.2Sense, 961: GAGTTACCAGGAGGCACTCG300Sense, 1098: AATTGCTGGAGGGCGAAGAA112
Antisense, 1260: TTAATGACCTCGCCATCCCGAntisense, 1209: TTGAGGTGGCCTTCTGACAC
  • In the first step of nested PCR, RT-PCR was used to amplify longer fragments from each gene of interest, which was followed by real-time PCR targeting sequences within the amplicons generated by the first RT-PCR step.