Table 1.

Primers used to generate in situ probes

GeneReverse primer containing T3 sequenceForward primerProbe size
Adra1bAGAATTAACCCTCACTAAAGGGTTTGTCCCCTTGAGACCTTGTGGAGGCTGCGCTTACACCTAC544 bp
Cited1AGAATTAACCCTCACTAAAGGGATCAGGTGAGGGGTAGGATGACTCTGAAGCGAGTGGCTAG472 bp
En1AGAATTAACCCTCACTAAAGGGGCAAGGTAGGGAGGAGGCAAGAACGGCCTGGCGCTG539 bp
GnaqAGAATTAACCCTCACTAAAGGGGATGCCACCTGCCAGTAAACCGGGAAGGGCTTCTTAGTTTTGTAC524 bp
Gria1AGAATTAACCCTCACTAAAGGGCCCTCGTTGAGAAGCGTCTTCGTTATCATTGGCAATGGACGAGC504 bp
Gria2AGAATTAACCCTCACTAAAGGGATTGAAGGTAGCTGTTCAGATACCTACATGTTACCATGTAGAATGCAAGTGG540 bp
Gria3AGAATTAACCCTCACTAAAGGGTTTAGGAATGCGTCTTAGTCTTTGCTTTGGAGAACTCCCCATAGTGGAG516 bp
Gria4-1AGAATTAACCCTCACTAAAGGGCTTGTCTCAGCGGAAGCACAGGAACTGCGATTAGACAGAG505 bp
Gria4-2AGAATTAACCCTCACTAAAGGGAACTGTATCATTGAACTCATTCATCTGTGGGTTTTGTACTCACCC526 bp
Hcrtr1AGAATTAACCCTCACTAAAGGGAAGGGCTGAGCCCAAATTAGTTCTCCTCTGCCAGACACAAGTCCTTG559 bp
Htr1a-1AGAATTAACCCTCACTAAAGGGCACCATAACCCAAAGTAGTTCGGAAGAAGTGGAGGAAGAGTGTAG550 bp
Htr1a-2AGAATTAACCCTCACTAAAGGGCGAAGTTCAGATATAACGCAAAACCCACGTAGAGGAGGTAAGGAGCAAAAG534 bp
Lpar1-1AGAATTAACCCTCACTAAAGGGTCATAGCATGACATTAGAGACCTTAGTCTCCTATTGGAAGAATCTTGTGTATATAAAACTTTGCC499 bp
Lpar1-2AGAATTAACCCTCACTAAAGGGAAGCCTGTGTATACTCGATTGGAGTTCAACTCTGCTATGAACCC538 bp
Nr3c1AGAATTAACCCTCACTAAAGGGTTACCGATCTTGATAGACCAGGCTGACAATCTGGGGAAAGGAAGGGGAC507 bp
Nxph4AGAATTAACCCTCACTAAAGGGCATACTGCGGCGTGGGCAATACTCGCGCGCTTTTAATTGCCAC550 bp
Pet-1AGAATTAACCCTCACTAAAGGGTTAATGGGGCTGAAAGGGATACCAGTGACCAATCCCATCCTC513 bp
Scn3bAGAATTAACCCTCACTAAAGGGAGATGGTGAAGATTTTAAGTTGGCTGGAGACAAAGATAGGTGTGTAGCTTC516 bp
Slc6a17AGAATTAACCCTCACTAAAGGGCCTCCAGATTGGAGATGTCCTTCATCATGATCGGGACCATGGCAG586 bp
Slc22a3-1AGAATTAACCCTCACTAAAGGGTGTATTCGGAGCTCAAGGGAAGCAGACGGTGGAAGACGTAG535 bp
Slc22a3-2AGAATTAACCCTCACTAAAGGGATGGCTAGCTGGATGCCCTGAGCTCCACGTCCCAGCTGAG577 bp
Tph2AGAATTAACCCTCACTAAAGGGATCCATCCCAACTGCTGTGTCTACACGCAGAGCATTGAA658 bp