Table 1.

Primer sequences for single-cell RT-PCR and qRT-PCR

PrimerSequenceAmplicon (bp)
GAPDH (glyceraldehyde 3-phosphate dehydrogenase; NCBI: GU214026.1)
    Outside, forwardAAATGGTGAAGGTCGGTGTGAACG542
    Outside, reverseAGTGATGGCATGGACTGTGGTCAT
    Nested, forwardaGCAAATTCAACGGCACAGTCAAGG255
    Nested, reverseaTCTCGTGGTTCACACCCATCACAA
VGlut2 (vesicular glutamate transporter 2; NCBI: AF324864.1)
    Outside, forwardCTGCTTCTGGTTGTTGGCTACTCT543
    Outside, reverseATCTCGGTCCTTATAGGTGTACGC
    Nested, forwardaCATCTCCTTCTTGGTGCTTGCAGT131
    Nested, reverseaACAGCGTGCCAACGCCATTTGAAA
Phox2b (paired-like homeobox 2b; NCBI: NM_008888.3)
    Outside, forwardCAGTGGCTTCCAGTATAACCCGAT238
    Outside, reverseAGCGAAGACCCTCTCCAACTCTTT
    Nested, forwardTACGCCGCAGTTCCATACAAACTC104
    Nested, reverseTCTTTGAGCTGCGCGCTTGTGAAG
GAD1 (glutamate decarboxylase 1; NCBI: NM_008077.4)
    Outside, forwardACAACCTTTGGCTGCATGTGGATG331
    Outside, reverseAATCCCACGGTGCCCTTTGCTTTC
    Nested, forwardAGTCACCTGGAACCCTC128
    Nested, reverseGCTTGTCTGGCTGGAA
Nalcn (sodium leak channel, nonselective; NCBI: NM_177393.4)
    Outside, forwardATGCTCAAAAGAAAGCAGAGTTCCA479
    Outside, reverseAATCGGAAATAAATCCTGAAAGCCC
    Nested, forwardATACTCTGGATTAATAAGCCA219
    Nested, reverseATAGGAGCTATCACCCTTGACAATT
    Quantitative, forwardTAATGAGATAGGCACGAGTA122
    Quantitative, reverseTGATGAAGTAGAAGTAGGAGC
NK1R (tachykinin receptor 1; NCBI: NM_009313.5)
    Outside, forwardATCGTGGTGACTTCCGTGGTG449
    Outside, reverseGTCCTGTTGGGATGTTCTGGC
    Nested, forwardCCCACAAGAGAATGAGGAC291
    Nested, reverseCCCAGATGACAAAGATGAC
    Quantitative, forwardCCTGCCCTACATCAACCCA143
    Quantitative, reverseTGAAGCCCAGACGGAACCT
NK2R (tachykinin receptor 2; NCBI: NM_009314.4 )
    Outside, forwardGCCACCTTCAACTTCATCTA494
    Outside, reverseGCCTTCACAAACTTCTTCTT
    Nested, forwardTCATCTACTTCCTGCCTCTA142
    Nested, reverseGCCTTCACAAACTTCTTCTT
NK3R (tachykinin receptor 3; NCBI: NM_021382.6)
    Outside, forwardAAAACTGGACGGACGGGAC649
    Outside, reverseCACTGCACATAGCAAAGGG
    Nested, forwardaAACTTCTTTCCCATCACAGCG149
    Nested, reverseaGCCAAAATCCAAATACTTCCG
  • aSame primers also used for qPCR.