Table 2.

Antibodies and chemicals used in the study

Reagent or resourcesSourceIdentifier
Antibodies
    Anti-Akt produced in rabbitCell Signaling Technology9272
    Anti-p-Akt produced in rabbitCell Signaling Technology4060
    Anti-mTOR produced in rabbitCell Signaling Technology2972
    Anti-p-mTOR produced in rabbitCell Signaling Technology5536
    Anti-p-eiF4E produced in rabbitCell Signaling Technology9741
    Anti-eiF4E produced in rabbitCell Signaling Technology9742
    Anti-p-4EBP1 produced in rabbitCell Signaling Technology2855
    Anti-4EBP1 produced in rabbitCell Signaling Technology9452
    Anti-ERK1/2 produced in rabbitCell Signaling Technology4695
    Anti-p-ERK1/2 produced in rabbitCell Signaling Technology4366
    Anti-S6 produced in rabbitCell Signaling Technology2217
    Anti-p-S6 produced in rabbitCell Signaling Technology5364
    Anti-RagA produced in rabbitCell Signaling Technology4357
    Anti-RPL10a produced in rabbitAbcamAb174318
    Anti-Atp6v1a produced in rabbitThermo Fisher ScientificPA5-29191
    Anti-CGRP produced in rabbitPeninsula LaboratoriesS3006.0001
    Anti-peripherin produced in rabbitSigma-AldrichSAB4502419
    IB4Thermo Fisher ScientificI21413
    Anti-NF200 produced in mouseSigma-AldrichN5389
    Anti-p-eIF4E produced in rabbitAbcamAB76256
    Htz-GFP produced in mouseMemorial Sloan Kettering19F8
    Htz-GFP produced in mouseMemorial Sloan Kettering19C7
    Anti-rabbit IgG, HRP-linked antibodyJackson ImmunoResearch Laboratories111-035-003
    Anti-mouse IgG, HRP-linked antibodyJackson ImmunoResearch Laboratories115-035-003
    Anti-puromycinDSHBPMY2A4
Chemicals, drugs
    AZD8055LC LaboratoriesA-2345
    eFT508eFFECTORMTA
    PaclitaxelSigma-AldrichY0000598
    RetigabineAlomone LabsR-100
    EmetineSigma-AldrichE-2375
    CycloheximideSigma-AldrichC7698
Commercial assays
    Direct-zol RNA MicroPrepZymo ResearchR2062
    Quantseq 3′ mRNA-Seq library kitLexogen047
    RiboCop rRNA depletion kitLexogen042.08
    QubitLexogenQ32854
    iScript cDNA synthesis kitBio-Rad1708890
    SybR Green SupermixBio-Rad1725270
    Clarity ECL SubstrateBio-Rad
    Immobilon Western ChemiluminescentMilliporeWBKLS0500
Deposited data
    RNA sequencing dataThis paperGSE113941
Experimental model: organism/strain
    Rosa26fsTRAPJackson ImmunoResearch Laboratories022367
    Nav1.8CreEMMA InfrafrontierEM04582
    eIF4ES209ANahum SonenbergNA
    Mnk1−/−Nahum SonenbergNA
Oligonucleotides
    GACAACTTTGGCATTGTGGAIDTGAPDH-F
    CATCATACTTGGCAGGTTTCTCIDTGAPDH-R
    ACGTCCGATTCTTGGGGAACIDTRraga -F
    TACGGAAGATGTTGTCCCGCIDTRraga -R
Software and algorithms
    Prism version 0.6GraphPadNA
    TopHat 2.10.1 with Bowtie 2.20.9LinuxNA
    GRCm38.p4 (gene code annotation .vM10)LinuxNA
    Samtools 1.30.1LinuxNA
    Cufflinks 2.20.1LinuxNA
    FastQ 0.11.5LinuxNA