Table 1.

qPCR primer sequences

GeneGene BankAmplicon sizeSequence 5′-3′
Reference genesOAZ1NM_00875351Fwd AGCGAGAGTTCTAGGGTTGCC
Rev CCCCGGACCCAGGTTACTAC
L27ABC086939101Fwd TGTTGGAGGTGCCTGTGTTCT
Rev CATGCAGACAAGGAAGGATGC
HPRTNM_013556.2150Fwd ACAGGCCAGACTTTGTTGGA
Rev ACTTGCGCTCATCTTAGGCT
Phagocytosis receptorsP2Y12NM_02757188Fwd GCAGAACCAGGACCATGGAT
Rev CTGACGCACAGGGTGCTG
MerTKNM_008587.1131Fwd AAGGTCCCCGTCTGTCCTAA
Rev GCGGGGAGGGGATTACTTTG
AxlNM_009465.486Fwd GTTGGTGTCTGGAGGATGGG
Rev TGTGTGTCCTTATGGGCTGC
Peptides and hormonesVGFNM_001039385.174Fwd CACCGGCTGTCTCTGGC
Rev AAGGAAGCAGAAGAGGACGG
CartptNM_013732.7106Fwd GCGCTATGTTGCAGATCGAAG
Rev GCGTCACACATGGGGACTTG
FGF2NM_008006.2113Fwd CGGCTGCTGGCTTCTAAGTG
Rev AGTGCCACATACCAACTGGAG
Trophic factorsVEGFANM_001025250.388Fwd GGCCTCCGAAACCATGAACT
Rev CTGGGACCACTTGGCATGG
PDGFαNM_008808.394Fwd TACCCCGGGAGTTGATCGAG
Rev TCAGCCCCTACGGAGTCTATC
IGF-1NM_010512.4122Fwd TTACTTCAACAAGCCCACAGG
NM_184052.3Rev GTGGGGCACAGTACATCTCC
NM_001111274.1
NM_001111275.1
NM_001111276.1
EGFNM_010113.3136Fwd GGACTGAGTTGCCCTGACTC
Rev CAATATGCATGCACACGCCA
GDNFNM_010275.2145Fwd CGCTGACCAGTGACTCCAA
Rev TGCCGATTCCTCTCTCTTCG
Matrix proteinMmp3NM_010809.288Fwd ACCCAGTCTACAAGTCCTCCA
Rev GGAGTTCCATAGAGGGACTGA
Surface ligandsJag1NM_013822.5119Fwd TTCAGGGCGATCTTGCATCA
Rev CACACCAGACCTTGGAGCAG
Dll4NM_019454.3113Fwd GGTTACACAGTGAGAAGCCAGA
Rev GGCAATCACACACTCGTTCC
CytokinesCsf3NM_009971.170Fwd GCAGCCCAGATCACCCAGAAT
Rev TGCAGGGCCATTAGCTTCAT
IL1βNM_000576.272Fwd AGATGAAGTGCTCCTTCCAGG
Rev GGTCGGAGATTCGTAGCTGG
IL6NM_000600.3107Fwd GAAAGCAGCAAAGAGGCACTG
Rev TTCACCAGGCAAGTCTCCTCAT
TNFαNM_000594.3142Fwd TGCACTTTGGAGTGATCGGC
Rev GCTTGAGGGTTTGCTACAACA
TGFβNM_000660.5112Fwd TCCTGGCGATACCTCAGCAA
Rev CAATTTCCCCTCCACGGCTC
  • List of primers used to amplify reference genes, phagocytosis receptors, peptides and hormones, trophic factors, matrix protein, surface ligands, and cytokines. The gene name, Gene Bank accession number, amplicon size, and sequence are listed.