Regular ArticleDistinct Molecular Phenotypes in Murine Cardiac Muscle Development, Growth, and Hypertrophy
References (0)
Cited by (54)
Novel roles of cardiac-derived erythropoietin in cardiac development and function
2024, Journal of Molecular and Cellular CardiologyMechanisms of Stress-Induced Cardiac Hypertrophy
2012, Muscle: Fundamental Biology and Mechanisms of DiseaseEnhanced desumoylation in murine hearts by overexpressed SENP2 leads to congenital heart defects and cardiac dysfunction
2012, Journal of Molecular and Cellular CardiologyCitation Excerpt :MLC2-v [46]: forward, 5′ GCCAAGAAGCGGATAGAAGG 3′; reverse, 5′ CTGTGGTTCAGGGCTCAGTC 3′. skeletal α-actin [45]: forward, 5′ AGACACCATGTGCGACGAAGA 3′; reverse, 5′ CCGTCCCCAGAATCCAACACGA 3′. GAPDH: forward, 5′ ATGTTCCAGTATGACTCCACTCAC 3′; reverse, 5′ GAAGACACCAGTAGACTCCACGA 3′.
Serotonin responsiveness through 5-HT<inf>2A</inf> and 5-HT<inf>4</inf> receptors is differentially regulated in hypertrophic and failing rat cardiac ventricle
2007, Journal of Molecular and Cellular CardiologyCitation Excerpt :In hypertrophy, the zinc-finger transcription factor GATA4 is supposed to play an important role by activation of several genes involved in the pathophysiological remodelling of the heart by promoting transcription of e.g. MHC-β [24], ANP and BNP [25]. Our observation of an increase in the mRNA expression of GATA4 (Fig. 1H) is different from that of Schoenfeld et al. [22] who did not observe any change in GATA4 mRNA in mice, which might indicate species differences or that GATA4 regulation is not a prerequisite for cardiac hypertrophy. This is supported by Bisping et al. [26] who demonstrated that partial GATA4 deficiency in mice did not impair expression of ANP, BNP and MHC-β in hypertrophy.
- f1
Please address all correspondence to: Dr. David G. Lowe, Cardiovascular Research, Genentech, Inc1 DNA Way, South San Francisco, CA 94080, USA.