β-Secretase cleavage of the amyloid precursor protein mediates neuronal apoptosis caused by familial Alzheimer’s disease mutations

doi:10.1016/S0169-328X(01)00294-7

Molecular Brain Research

Volume 97, Issue 1, 16 December 2001, Pages 103-113

https://doi.org/10.1016/S0169-328X(01)00294-7 Get rights and content

Abstract

The amyloid precursor protein (APP) is cleaved by two enzymes, β-secretase and γ-secretase, to generate the pathological amyloid β (Aβ) peptide. Expression of familial Alzheimer’s disease (FAD) mutants of APP in primary neurons causes both intracellular accumulation of the C-terminal β-secretase cleavage product of APP and increased secretion of Aβ, and eventually results in apoptotic death of the cells. To determine whether either of these two processing products of APP is involved in this apoptotic pathway, we first modeled experimentally the accumulation of the β-secretase cleavage product in neurons. The C-terminal 100 amino acids (C100) of APP, with and without a signal peptide, was expressed in cells via recombinant herpes simplex virus (HSV) vectors. Both transgene products were targeted to the membrane, and both caused apoptosis in the neurons, implicating the β-secretase cleavage product of APP in apoptosis caused by FAD APPs. Expression in neurons of a mutant of FAD APP that inhibited β-secretase cleavage inhibited its ability to cause apoptosis. However, expression in neurons of a mutant of FAD APP that inhibited γ-secretase cleavage did not inhibit the ability of this mutant to cause apoptosis. These data suggested that the C-terminal β-secretase cleavage product of APP, but not Aβ, mediates the apoptosis caused by FAD mutants of APP. Consistent with this hypothesis, C31, which is generated from the β-secretase cleavage product, itself caused neuronal apoptosis. Inhibitors of caspases 3, 6 and 8, but not of caspase 9, inhibited the apoptosis caused by FAD mutants of APP. It may be inferred from these data that β-secretase cleavage of FAD mutants of APP allows the appropriate caspase access to its site of action to produce C31, which directly causes neuronal apoptosis.

Introduction

The amyloid precursor protein (APP) is the source of the amyloid β peptide (Aβ) that is deposited in the brain in Alzheimer’s disease (AD). Specific mutations in this gene can cause some forms of familial Alzheimer’s disease (FAD); these mutations increase both β-secretase and γ-secretase cleavage of APP, both of which are required for the generation of Aβ. These FAD APP mutations also cause neuronal apoptosis in vitro [34], [38]. It is not known whether β- or γ-secretase cleavage of FAD APPs, or both, plays a causal role in this apoptosis.

Exogenously-applied Aβ can, under certain conditions, lead to the induction of apoptotic pathways in neurons (reviewed in Ref. [6]). Furthermore, all of the FAD APP mutations cause increased overall secretion of Aβ or of the ‘long’ (42–43-amino acid) form of Aβ relative to the shorter 40-amino acid form [4], [7], [29]. These data would suggest that the increased Aβ or Aβ42(43) resulting from expression of FAD APP may play a role in the consequent apoptosis. However, amyloidogenic C-terminal fragments of APP that are similar to the β-secretase cleavage product are neurotoxic in vitro and cause neurodegeneration in vivo [10], [21], [22], [36]. Therefore, it is not clear which, if either of these fragments might be involved in the neuronal apoptosis caused by FAD mutants of APP. This is an important question to answer, because both β- and γ-secretase inhibitors are being considered as therapeutics for AD.

It has been shown previously that FAD mutants of APP cause apoptosis in primary neurons [34], [38]. We have also shown that expression of these mutants in primary neurons causes both intracellular accumulation of the C-terminal β-secretase cleavage product of APP and increased secretion of Aβ [19]. We asked which, if either of these events contributes to the apoptosis caused by the mutants. The data presented below suggest that accumulation of the β-secretase cleavage product of FAD APPs, and consequent production of C31 from this cleavage product by caspases 3, 6 and/or caspase 8, mediate this apoptosis.

Section snippets

Generation of recombinant herpes simplex virus (HSV) vectors

To make a HSV construct encoding the β-secretase cleavage product of APP fused to a signal peptide (sig99), we annealed together the following oligonucleotides and ligated them to the vector pHSVPrpUC [19] that had been cleaved with HindIII and EcoRI: forward oligonucleotide: 5′AGCTTGCCGCCACCATGCTGCCCGGTTTGGCACTGCTCCTGCTGGCCGCCTGGACGGCTCGGGCGCTGGATGCAG3′; reverse oligonucleotide: AATTCTGCATCCAGCGCCCGAGCCGTCCAGGCGGCCAGCAGGAGCAGTGCCAAACCGGGCAGCATGGTGGCGGCA. This construct was digested with EcoRI

Both C100 and sigC99 are targeted to the membrane in HSV-infected neurons

We infected primary rat cortical neurons in culture with HSV vectors expressing the C-terminal 100 amino acids of APP (HSV/C100) or the C-terminal 99 amino acids of APP fused to a signal peptide (HSV/sigC99); 16 h later we harvested the cells. The two HSV constructs were shown to express equivalent levels of transgene product (Fig. 1A), and C100 and sigC99 displayed comparably low levels of aggregation. Interestingly, sigC99 appears to be more readily cleaved by α-secretase, as the band

Discussion

We have shown that expression of C100 or sigC99 in neurons, to simulate the accumulation of the C-terminal β-secretase cleavage product of APP that occurs when FAD APP mutants are expressed in the cells, causes induction of apoptosis. Furthermore, inhibition of β-secretase cleavage of an FAD mutant of APP abrogates the ability of this mutant to cause neuronal apoptosis, whereas inhibition of γ-secretase cleavage of an FAD mutant of APP does not decrease the level of apoptosis caused by this

Acknowledgements

We thank Dr. Robert Coopersmith for statistical assistance. This work was supported by National Institutes of Health Grant AG12954 (R.L.N.).

References (38)

C.W. Cotman
Apoptosis decision cascades and neuronal degeneration in Alzheimer’s disease
Neurobiol. Aging
(1998)
M. Citron et al.
Generation of amyloid β protein from its precursor is sequence specific
Neuron
(1995)
T. Dyrks et al.
Generation of βA4 from the amyloid protein precursor and fragments thereof
FEBS Lett.
(1993)
S.P. Fraser et al.
Ionic effects of the Alzheimer’s disease β-amyloid precursor protein and its metabolic fragments
Trends Neurosci.
(1997)
F.G. Gervais et al.
Involvement of caspases in proteolytic cleavage of Alzheimer’s amyloid-β precursor protein and amyloidogenic Aβ peptide formation
Cell
(1999)
I. Hussain et al.
Identification of a novel aspartic protease (Asp 2) as β-secretase
Mol. Cell. Neurosci.
(1999)
D. Ingram
Vaccine development for Alzheimer’s disease: a shot of good news
Trends Neurosci.
(2001)
P. Kermer et al.
Caspase-9: involvement in secondary death of axotomized rat retinal ganglion cells in vivo
Mol. Brain Res.
(2000)
A. LeBlanc et al.
Caspase-6 role in apoptosis of human neurons, amyloidogenesis, and Alzheimer’s disease
J. Biol. Chem.
(1999)
D.L. McPhie et al.
Neuronal expression of β-amyloid precursor protein Alzheimer mutations causes intracellular accumulation of a C-terminal fragment containing both the amyloid beta and cytoplasmic domains
J. Biol. Chem.
(1997)

M.P. Murphy et al.

γ-Secretase, evidence for multiple proteolytic activities and influence of membrane positioning of substrate on generation of amyloid beta peptides of varying length

J. Biol. Chem.

(1999)

L. Pellegrini et al.

Alternative, non-secretase processing of Alzheimer’s β-amyloid precursor protein during apoptosis by caspase-6 and -8

J. Biol. Chem.

(1999)

S. Soriano et al.

The amyloidogenic pathway of amyloid precursor protein (APP) is independent of its cleavage by caspases

J. Biol. Chem.

(2001)

R. Vassar et al.

Aβ-generating enzymes: recent advances in β- and γ-secretase research

Neuron

(2000)

A. Weidemann et al.

Proteolytic processing of the Alzheimer’s disease amyloid precursor protein within its cytoplastmic domain by caspase-like proteases

J. Biol. Chem.

(1999)

N.Y. Barnes et al.

Increased production of amyloid precursor protein provides a substrate for caspase-3 in dying motoneurons

J. Neurosci.

(1998)

S. Bursztajn et al.

Overexpression in neurons of human presenilin-1 or a presenilin-1 familial Alzheimer disease mutant does not enhance apoptosis

J. Neurosci.

(1998)

J.D. Buxbaum et al.

Processing of Alzheimer β/A4 amyloid precursor protein: modulation by agents that regulate protein phosphorylation

Proc. Natl. Acad. Sci. USA

(1990)

X.D. Cai et al.

Release of excess amyloid β protein from a mutant amyloid beta protein precursor

Science

(1993)

Cited by (58)

Neuregulin 1/ErbB4/Akt signaling attenuates cytotoxicity mediated by the APP-CT31 fragment of amyloid precursor protein
2021, Experimental and Molecular Pathology
Alzheimer's disease (AD) is a progressive neurodegenerative disease characterized by neuronal and synaptic loss. The cytoplasmic tail of amyloid precursor protein (APP) undergoes sequential cleavage at a specific intracellular caspase site to generate the cytoplasmic terminal 31 (CT31) fragment. The APP-CT31 fragment is a potent inducer of apoptosis. The cytotoxicity of APP-CT31 in SH-SY5Y cells was evaluated by the lactate dehydrogenase (LDH) assay. TUNEL staining was used to detect apoptotic signals in SH-SY5Y cells and primary cortical neurons. The expression of apoptosis-related proteins, such as p53, PUMA (p53 up-regulated modulator of apoptosis), and cleaved was investigated by immunofluorescence analysis and Western blotting. In this study, we investigated the neuroprotective effect of neuregulin 1 (NRG1) against cytotoxicity induced by APP-CT31. Our data showed that CT31 induced cytotoxicity and apoptosis in SH-SY5Y cells and primary cortical neurons. NRG1 attenuated the neurotoxicity induced by the expression of APP-CT31. We also showed that APP-CT31 altered the expression of p53 and cleaved caspase 3. However, treatment with NRG1 rescued the APP-CT31-induced upregulation of p53 and cleaved caspase 3 expression. The protective effect of NRG1 was abrogated by inhibition of the ErbB4 receptor and Akt. These results indicate an important role of ErbB4/Akt signaling in NRG1-mediated neuroprotection, suggesting that endogenous NRG1/ErbB4 signaling represents a valuable therapeutic target in AD.
TFEB-mediated Enhancement of the Autophagy-lysosomal Pathway Dually Modulates the Process of Amyloid β-Protein Generation in Neurons
2019, Neuroscience
Abnormalities of the autophagy-lysosomal pathway (ALP) have been implicated in the pathology of Alzheimer’s disease (AD). Activation of TFEB (transcription factor EB), a master regulator of the ALP, leads to ALP facilitation. The present study sought to clarify whether TFEB-mediated ALP facilitation influences the process of amyloid β-protein (Aβ) generation in neurons. TFEB was overexpressed in mature rat primary cortical neurons via recombinant adenoviruses, without (basal conditions) or with co-overexpression of wild-type amyloid precursor protein (APP) or its β-C-terminal fragment (β-CTF). We confirmed that TFEB overexpression upregulated the lysosomal proteins, cathepsin D and LAMP-1. In TFEB-expressing neurons, protein levels of ADAM10 were profoundly increased, whereas those of APP, BACE1, or γ-secretase complex proteins were unaffected. However, TFEB did not affect ADAM10 mRNA levels. TFEB overexpression had different effects on Aβ production depending on the expression level of APP or β-CTF: TFEB slightly decreased Aβ secretion under basal conditions; clearly increased α-CTF levels and marginally increased β-CTF levels with modest increases in secreted Aβ in APP-expressing neurons; and caused a remarkable increase in β-CTF levels with a significant increase in secreted Aβ in β-CTF-expressing neurons. Inhibition of proteasomes, but not lysosomes, markedly increased β-CTF levels in β-CTF-expressing neurons. These results collectively indicate that TFEB modulates Aβ production not only by increasing α-secretase processing of APP through ADAM10 upregulation but also by augmenting β-CTF levels possibly via altered proteasome-mediated catabolism. Thus, TFEB-mediated ALP enhancement appears to have dual, but opposite, effects on Aβ production in neurons.
Partial BACE1 reduction in a Down syndrome mouse model blocks Alzheimer-related endosomal anomalies and cholinergic neurodegeneration: Role of APP-CTF
2016, Neurobiology of Aging
β-amyloid precursor protein (APP) and amyloid beta peptide (Aβ) are strongly implicated in Alzheimer's disease (AD) pathogenesis, although recent evidence has linked APP-βCTF generated by BACE1 (β-APP cleaving enzyme 1) to the development of endocytic abnormalities and cholinergic neurodegeneration in early AD. We show that partial BACE1 genetic reduction prevents these AD-related pathological features in the Ts2 mouse model of Down syndrome. Partially reducing BACE1 by deleting one BACE1 allele blocked development of age-related endosome enlargement in the medial septal nucleus, cerebral cortex, and hippocampus and loss of choline acetyltransferase (ChAT)-positive medial septal nucleus neurons. BACE1 reduction normalized APP-βCTF elevation but did not alter Aβ40 and Aβ42 peptide levels in brain, supporting a critical role in vivo for APP-βCTF in the development of these abnormalities. Although ameliorative effects of BACE1 inhibition on β-amyloidosis and synaptic proteins levels have been previously noted in AD mouse models, our results highlight the additional potential value of BACE1 modulation in therapeutic targeting of endocytic dysfunction and cholinergic neurodegeneration in Down syndrome and AD.
The endocrine dyscrasia that accompanies menopause and andropause induces aberrant cell cycle signaling that triggers re-entry of post-mitotic neurons into the cell cycle, neurodysfunction, neurodegeneration and cognitive disease
2015, Hormones and Behavior
Citation Excerpt :
Reactivation of the cell cycle following increased AβPP expression or processing involves the upregulation of p21-activated kinase-3 (McPhie et al., 2003), cyclins D1 and B1, and Rb (Ahn et al., 2008; Malik et al., 2008). Overexpression of wild-type AβPP (Bursztajn et al., 1998; McPhie et al., 2001; Nishimura et al., 1998) and familial AD mutant AβPP (McPhie et al., 2001; Yamatsuji et al., 1996) has been shown to induce apoptosis in both primary neurons and cell lines. Therefore, the regulated processing of AβPP appears necessary for maintaining normal cell cycle dynamics.
This article is part of a Special Issue “SBN 2014”.
Sex hormones are physiological factors that promote neurogenesis during embryonic and fetal development. During childhood and adulthood these hormones support the maintenance of brain structure and function via neurogenesis and the formation of dendritic spines, axons and synapses required for the capture, processing and retrieval of information (memories). Not surprisingly, changes in these reproductive hormones that occur with menopause and during andropause are strongly correlated with neurodegeneration and cognitive decline. In this connection, much evidence now indicates that Alzheimer's disease (AD) involves aberrant re-entry of post-mitotic neurons into the cell cycle. Cell cycle abnormalities appear very early in the disease, prior to the appearance of plaques and tangles, and explain the biochemical, neuropathological and cognitive changes observed with disease progression. Intriguingly, a recent animal study has demonstrated that induction of adult neurogenesis results in the loss of previously encoded memories while decreasing neurogenesis after memory formation during infancy mitigated forgetting. Here we review the biochemical, epidemiological and clinical evidence that alterations in sex hormone signaling associated with menopause and andropause drive the aberrant re-entry of post-mitotic neurons into an abortive cell cycle that leads to neurite retraction, neuron dysfunction and neuron death. When the reproductive axis is in balance, gonadotropins such as luteinizing hormone (LH), and its fetal homolog, human chorionic gonadotropin (hCG), promote pluripotent human and totipotent murine embryonic stem cell and neuron proliferation. However, strong evidence supports menopausal/andropausal elevations in the LH:sex steroid ratio as driving aberrant mitotic events. These include the upregulation of tumor necrosis factor; amyloid-β precursor protein processing towards the production of mitogenic Aβ; and the activation of Cdk5, a key regulator of cell cycle progression and tau phosphorylation (a cardinal feature of both neurogenesis and neurodegeneration). Cognitive and biochemical studies confirm the negative consequences of a high LH:sex steroid ratio on dendritic spine density and human cognitive performance. Prospective epidemiological and clinical evidence in humans supports the premise that rebalancing the ratio of circulating gonadotropins:sex steroids reduces the incidence of AD. Together, these data support endocrine dyscrasia and the subsequent loss of cell cycle control as an important etiological event in the development of neurodegenerative diseases including AD, stroke and Parkinson's disease.
Early hyperactivity in lateral entorhinal cortex is associated with elevated levels of AβPP metabolites in the Tg2576 mouse model of Alzheimer's disease
2015, Experimental Neurology
Citation Excerpt :
In fact, the overexpression of human AβPP in olfactory sensory neurons has been shown to lead to apoptosis and changes in neuronal morphology (Cheng et al., 2011, 2013). For example, other AβPP metabolites such as AβPP-CTFs and soluble AβPP have been shown to induce neurotoxicity, cell death and resulting memory loss (Bach et al., 2001; Bertrand et al., 2001; Devi and Ohno, 2012; Dewachter et al., 2002; Deyts et al., 2012; Lu et al., 2000; McPhie et al., 2001; Sopher et al., 1994; Tamayev and D'Adamio, 2012; Tamayev et al., 2012; Yankner et al., 1989). Our present results demonstrate high levels of AβPP-CTFs in neurons in brain regions corresponding to the olfactory pathway, with higher levels in the aPCX than in HPX, LEC, and OB, and the lowest found in the cerebellum.
Alzheimer's disease (AD) is a neurodegenerative disorder which is the most common cause of dementia in the elderly today. One of the earliest symptoms of AD is olfactory dysfunction. The present study investigated the effects of amyloid β precursor protein (AβPP) metabolites, including amyloid-β (Aβ) and AβPP C-terminal fragments (CTF), on olfactory processing in the lateral entorhinal cortex (LEC) using the Tg2576 mouse model of human AβPP over-expression. The entorhinal cortex is an early target of AD related neuropathology, and the LEC plays an important role in fine odor discrimination and memory. Cohorts of transgenic and age-matched wild-type (WT) mice at 3, 6, and 16 months of age (MO) were anesthetized and acute, single-unit electrophysiology was performed in the LEC. Results showed that Tg2576 exhibited early LEC hyperactivity at 3 and 6 MO compared to WT mice in both local field potential and single-unit spontaneous activity. However, LEC single-unit odor responses and odor receptive fields showed no detectable difference compared to WT at any age. Finally, the very early emergence of olfactory system hyper-excitability corresponded not to detectable Aβ deposition in the olfactory system, but rather to high levels of intracellular AβPP-CTF and soluble Aβ in the anterior piriform cortex (aPCX), a major afferent input to the LEC, by 3 MO. The present results add to the growing evidence of AβPP-related hyper-excitability, and further implicate both soluble Aβ and non-Aβ AβPP metabolites in its early emergence.
Endogenous Aβ causes cell death via early tau hyperphosphorylation
2011, Neurobiology of Aging
Citation Excerpt :
The Ser262 tau epitope is localized in the microtubule-binding domains of the C-tail of tau and the hyperphosphorylation at such site has been proposed to be more detrimental than other sites, in terms of decreasing tau's biological activity of promoting and stabilizing microtubules (Drewes et al., 1995; Sengupta et al., 1998). It is noteworthy that our and other research groups have reported that Aβ antibodies can reduce (Piccini et al., 2000; De Berardinis et al., 2001; Tampellini et al., 2007; Matrone et al., 2008a,b) or amplify apoptosis in cultured cell lines or neurons (Estus et al., 1997; Rohn et al., 2000; McPhie et al., 2001) and can attenuate tau hyperphosphorylation in vitro and in vivo (Ma et al., 2006; Oddo et al., 2004). Furthermore, in 3XTg-AD mice which develop both amyloid plaques and NFT (Oddo et al., 2003a,b, 2004) provided experimental evidences that the immune-mediated Aβ clearance reduced early, but not late AT8 (Ser 202/Thr 205site) tau hyperphosphorylation as well as its pre-tangle somatodendritic accumulations.
Alzheimer's disease (AD) is characterized by Aβ overproduction and tau hyperphosphorylation. We report that an early, transient and site-specific AD-like tau hyperphosphorylation at Ser262 and Thr231 epitopes is temporally and causally related with an activation of the endogenous amyloidogenic pathway that we previously reported in hippocampal neurons undergoing cell death upon NGF withdrawal [Matrone, C., Ciotti, M.T., Mercanti, D., Marolda, R., Calissano, P., 2008b. NGF and BDNF signaling control amyloidogenic route and Ab production in hippocampal neurons. Proc. Natl. Acad. Sci. 105, 13138–13143]. Such tau hyperphosphorylation, as well as apoptotic death, is (i) blocked by 4G8 and 6E10 Aβ antibodies or by specific β and/or γ-secretases inhibitors; (ii) temporally precedes tau cleavage mediated by a delayed (6–12 h after NGF withdrawal) activation of caspase-3 and calpain-I; (iii) under control of Akt-GSK3β-mediated signaling. Finally, we show that such site-specific tau hyperphosphorylation causes tau detachment from microtubules and an impairment of mitochondrial trafficking.
These results depict, for the first time, a rapid interplay between endogenous Aβ and tau post-translational modifications which act co-ordinately to compromise neuronal functions in the same neuronal system, under physiological conditions as seen in AD brain.

View all citing articles on Scopus

^☆: Published on the World Wide Web on 6 November 2001.

View full text

Interactive reportβ-Secretase cleavage of the amyloid precursor protein mediates neuronal apoptosis caused by familial Alzheimer’s disease mutations☆

Abstract

Introduction

Section snippets

Generation of recombinant herpes simplex virus (HSV) vectors

Both C100 and sigC99 are targeted to the membrane in HSV-infected neurons

Discussion

Acknowledgements

Neurobiol. Aging

Neuron

FEBS Lett.

Trends Neurosci.

Cell

Mol. Cell. Neurosci.

Trends Neurosci.

Mol. Brain Res.

J. Biol. Chem.

J. Biol. Chem.

J. Biol. Chem.

J. Biol. Chem.

J. Biol. Chem.

Neuron

J. Biol. Chem.

Increased production of amyloid precursor protein provides a substrate for caspase-3 in dying motoneurons

J. Neurosci.

Overexpression in neurons of human presenilin-1 or a presenilin-1 familial Alzheimer disease mutant does not enhance apoptosis

J. Neurosci.

Processing of Alzheimer β/A4 amyloid precursor protein: modulation by agents that regulate protein phosphorylation

Proc. Natl. Acad. Sci. USA

Release of excess amyloid β protein from a mutant amyloid beta protein precursor

Science

Interactive report
β-Secretase cleavage of the amyloid precursor protein mediates neuronal apoptosis caused by familial Alzheimer’s disease mutations☆