Abstract
The localization of acetylcholine receptors (AChRs) to the vertebrate neuromuscular junction is mediated, in part, through selective transcription of AChR subunit genes in myofiber subsynaptic nuclei. Agrin and the muscle-specific receptor tyrosine kinase, MuSK, have critical roles in synapse-specific transcription, because AChR genes are expressed uniformly in mice lacking either agrin or MuSK. Several lines of evidence suggest that agrin and MuSK stimulate synapse-specific transcription indirectly by regulating the distribution of other cell surface ligands, which stimulate a pathway for synapse-specific gene expression. This putative secondary signal for directing AChR gene expression to synapses is not known, but Neuregulin-1 (Nrg-1), primarily based on its presence at synapses and its ability to induce AChR gene expression in vitro, has been considered a good candidate. To study the role of Nrg-1 at neuromuscular synapses, we inactivated nrg-1 in motor neurons, skeletal muscle, or both cell types, using mice that express Cre recombinase selectively in developing motor neurons or in developing skeletal myofibers. We find that AChRs are clustered at synapses and that synapse-specific transcription is normal in mice lacking Nrg-1 in motor neurons, myofibers, or both cell types. These data indicate that Nrg-1 is dispensable for clustering AChRs and activating AChR genes in subsynaptic nuclei during development and suggest that these aspects of postsynaptic differentiation are dependent on Agrin/MuSK signaling without a requirement for a secondary signal.
Introduction
A hallmark of neuromuscular synapse formation is the localization of multiple proteins, including acetylcholine receptors (AChRs), the muscle-specific receptor tyrosine kinase, MuSK, neuregulin-1 (Nrg-1), and ErbBs to the postsynaptic myofiber membrane. Additionally, the genes encoding AChR subunits and MuSK are selectively transcribed in subsynaptic myofiber nuclei (Sanes and Lichtman, 2001; Burden, 2002).
The clustering of synaptic proteins is dependent on MuSK. MuSK is activated by motor neuron-derived agrin (Glass et al., 1996), and mice lacking Agrin or MuSK lack neuromuscular synapses, because postsynaptic proteins fail to cluster and genes that are normally expressed preferentially in the synaptic region of muscle are expressed uniformly in myofibers (DeChiara et al., 1996; Gautam et al., 1996). MuSK is also sufficient for clustering synaptic proteins and inducing “synaptic genes,” because ectopic expression of Agrin or constitutively active MuSK stimulates AChR clustering and AChR transcription (Cohen et al., 1997; Jones et al., 1997, 1999; Moore et al., 2001; Lacazette et al., 2003).
Nrg-1, a ligand for ErbBs, has been implicated in regulating synapse-specific transcription, because Nrg-1 stimulates expression of certain genes, including AChR genes, in cultured muscle cells (Falls et al., 1993; Chu et al., 1995; Gramolini et al., 1999; Ip et al., 2000). Moreover, Nrg-1 and ErbBs are concentrated at synapses (Goodearl et al., 1995; Jo et al., 1995; Moscoso et al., 1995; Zhu et al., 1995), and the response of AChR genes to Nrg-1 in vitro and synapse-specific transcription in vivo depend on the same cis-regulatory elements (Gundersen et al., 1993; Tang et al., 1994; Fromm and Burden, 1998; Schaeffer et al., 1998). Nrg-1 is expressed by motor neurons, suggesting that Nrg-1 may regulate muscle differentiation in a paracrine manner (Sandrock et al., 1995). Nrg-1, however, is also expressed by muscle (Corfas et al., 1995; Rimer et al., 1998). Moreover, muscle-derived Nrg-1 and ErbBs are clustered by Agrin, raising the possibility that Nrg-1 may act in an autocrine manner, downstream of MuSK, to regulate synaptic differentiation (Meier et al., 1998; Rimer et al., 1998; Moore et al., 2001; Lacazette et al., 2003).
Analysis of the potential role for Nrg-1 in synapse-specific transcription is complicated by its requirement in other developmental processes that precede synapse formation and by the presence of multiple Nrg-1 receptors at synapses (Gassmann et al., 1995; Lee et al., 1995; Meyer and Birchmeier, 1995; Riethmacher et al., 1997; Morris et al., 1999; Woldeyesus et al., 1999). Conditional inactivation of Nrg-1 in sensory and motor neurons, which leads to a loss of Schwann cells and a subsequent loss of motor axons from muscle, does not affect the pattern of AChR gene expression, implying that neuronal Nrg-1 is dispensable for synapse-specific transcription (Yang et al., 2001). These results, however, do not exclude the possibility that neuronal Nrg-1 regulates the level of AChR expression or that muscle-derived Nrg-1 is critical for synapse-specific transcription. Here, we conditionally inactivate nrg-1 in skeletal muscle, motor neurons, or both cell types and quantitatively assess AChR expression. We find that Nrg-1 is dispensable for synapse-specific transcription and clustering of synaptic AChRs during development.
Materials and Methods
Mouse strains and genotyping. Isl1cre mice have been described previously (Srinivas et al., 2001). Mice were genotyped by PCR using a primer within the neomycin cassette (TGGCTACCCGTGATATTGCT) and a primer within the isl1 locus (GGCTCTCTCCACCACATCGT). Human skeletal actin (HSA)::cre mice have been described previously (Miniou et al., 1999); mice were genotyped by PCR using a primer in the HSA promoter (AAGTGAAGCCTCGCTTCC) and a primer in the cre coding region (CCTCATCACTCGTTGCATCGA). Z/AP mice, carrying a floxed lacZ expression cassette, have been characterized previously (Lobe et al., 1999); the mice were genotyped by PCR using a pair of primers in the hPLAP coding sequence (CCGCTTCCCATATGTGGCTCTGTCC and GCATGA GCTCAGTGCGGTTCCACAC). The nrg-1 null allele, lacking exons 7, 8, and 9, has been described previously (Meyer and Birchmeier, 1995). Because exons 7 and 8 encode the epidermal growth factor-like domain, which is required to activate ErbB receptors, the mutant allele is a null. In nrg-1f mice, exons 7, 8, and 9 are flanked by loxP sites, allowing conditional inactivation of nrg-1 (Yang et al., 2001). LoxP-flanked and wild-type alleles were detected using primers in nrg-1 (GAGATGGTCATGTCCTTGTCACTAAC and GCACCAAGTGGTTGCGATTGTTGCT); the null allele was detected using a primer in nrg-1 (GAGATGGTCATGTCCTTGTCACTAAC) and a primer in the neomycin cassette (CGAATTCGCCAATGACAAGACGCTG).
Histology and measurement of β-galactosidase activity. Cryostat cross sections (10 μm) from hindlimbs, diaphragm, and intercostal muscles [embryonic day 18.5 (E18.5)] were fixed for 10 min in PBS containing 2% formaldehyde, 0.2% glutaraldehyde, 50 mm EGTA, and 100 mm magnesium chloride and washed twice with buffer A (PBS containing 2 mm magnesium chloride, 0.02% Nonidet P-40, and 0.01% sodium deoxycholate) for 5 min at room temperature. Sections were stained for β-galactosidase (β-gal) activity with 0.5 mg/ml 5-bromo-4-chloro-3-indolyl-βd-galactoside (X-gal), 5 mm potassium ferrocyanide, 5 mm potassium ferricyanide, and 1.25% dimethylformamide in buffer A at 37°C in the dark. The staining reaction was allowed to proceed for 0.25, 0.5, 1, 4, or 10 h. Sections were washed twice for 5 min with buffer A at room temperature and mounted under GelMount (Biomeda, Foster City, CA).
Images, which were captured on a Sony (Tokyo, Japan) DKC500 camera, were analyzed with NIH ImageJ. Grayscale values for 40 muscle fibers in each muscle were determined at each time point. Because mean grayscale values of unstained sections and stained sections from wild-type mice were identical, these values were averaged and used as a base-line for measuring product accumulation in Z/AP and HSA::cre; Z/AP mice. β-Gal activity in skin and bone from Z/AP mice and HSA::cre; Z/AP mice were indistinguishable (data not shown), indicating that HSA::cre is not detectably expressed in skin and bone. For each animal, we plotted the average grayscale value in myofibers over time. For Z/AP mice, we plotted product accumulation during the first hour; for HSA::cre; Z/AP mice, we plotted product accumulation during the entire 10 h reaction period. The slopes were generated by linear regression (R2 values for the slopes were larger than 0.9) and were used to compare enzyme activity.
Immunohistochemistry. Diaphragm and gastrocnemius muscles were fixed for 1 h at room temperature (1% formaldehyde in PBS) and then overnight at 4°C (0.2% formaldehyde in PBS). Unless indicated otherwise, all incubations were performed at room temperature. Gastrocnemius muscles were teased into bundles of muscle fibers. Muscles were washed twice for 15 min in PBS, incubated 15 min with 100 mm glycine in PBS, and rinsed in PBS. After removal of the overlying connective tissue, muscles were permeabilized and blocked for 1 h in PBS containing 2% bovine serum albumin, 4% normal goat serum, and 0.5% Triton X-100.
To label axons, AChRs, and muscle fibers, muscles were incubated at 4°C overnight with rabbit polyclonal antibodies against neurofilament (1:500; Chemicon, Temecula, CA) and synaptophysin (1:5; Zymed, San Francisco, CA) in blocking solution. After three washes (1 h per wash) in PBS containing 0.5% Triton X-100 (PBT), muscles were incubated for 2 h with fluorescein-conjugated donkey anti-rabbit IgG (1:200; Jackson ImmunoResearch, West Grove, PA), Alexa594-conjugated α-bungaratoxin (α-Bgt; 1:1000; Invitrogen, San Diego, CA), and Alexa660-conjugated phalloidin (1:100; Invitrogen) in blocking solution.
To quantitate the number and density of AChRs, muscles were stained only with Alexa594-α-Bgt, first for 1 h at room temperature and then overnight at 4°C. After three 30 min washes in PBT, muscles were rinsed in PBS, fixed 30 min with 1% formaldehyde in PBS, washed three times for 10 min in PBS, and flat-mounted in Vectashield (Vector Laboratories, Burlingame, CA). Images were captured using a Zeiss (Oberkochen, Germany) LSM 510 confocal microscope.
Quantitation of synaptic AChRs. To compare AChR levels and density between wild-type and nrg-1 mutant endplates, confocal image stacks of Alexa594-α-Bgt-stained muscles were captured at a subsaturating amplifier gain, which was not modified during the course of the experiment. Moreover, we confirmed the validity of this assay by including increasing amounts of unlabeled α-Bgt, together with Alexa594-α-Bgt, and showing that the fluorescence intensity was reduced in a linear manner (data not shown). The data were quantitated using Volocity 3D software (Improvision, Lexington, MA). For each AChR cluster, we determined the average fluorescence intensity per cubic micrometer and the summed fluorescence intensity of all voxels associated with the cluster. We analyzed at least 77 synapses in each E18.5 embryo and > 20 synapses in each postnatal day 21 (P21) mouse. Mean AChR density from multiple mice (n is indicated in the figure legends) with the same genotype was determined. We used a two-tailed t test to determine whether differences in AChR density were statistically significant. Because AChR densities in P21 nrg-1f/- and nrg-1f/+ mice were not significantly different (data not shown), these genotypes were grouped.
In situ hybridization. Intercostal muscles were fixed in 4% formaldehyde, dehydrated in methanol, digested with proteinase K, hybridized with digoxigenin-labeled riboprobes directed against mRNAs encoding AChR α subunit (DeChiara et al., 1996), AChR δ subunit (Simon et al., 1992), AChR ϵ subunit (nucleotides 165-1485 from start codon; GenBank accession number NM 009603), MuSK (Herbst et al., 2002), or Utrophin (Utrn) (nucleotides 119-865 from start codon; GenBank accession number NM 011682), and processed as described previously (Wilkinson, 1998; Yang et al., 2001). Labeling with sense probes resulted in weak, uniform staining for each gene (data not shown).
Quantitative reverse transcription-PCR. Gastrocnemius muscles were homogenized at 4°C in RNA STAT-60 (Tel-Test, Friendswood, TX) using a PT 10/35 Polytron (Kinematica AG, Littau-Lucerne, Switzerland), and RNA was isolated according to the manufacturer's recommendations. After treatment with DNase I, RNA was reverse transcribed using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). Five percent of each reverse transcription (RT) reaction was used for quantitative PCR using iQ SYBR Green Supermix (Bio-Rad) on an Opticon 2 real-time thermocycler (Bio-Rad). Relative expression levels of AChR δ subunit and MuSK were normalized to glyceraldehyde-3-phosphate dehydrogenase (gapdh) expression. The linearity of quantitative PCRs was confirmed by analyzing serial dilutions of samples, and each reaction was performed in duplicate. The primers used for PCR amplification were TGCATCCTGCACCACCAACT and ATGCCTGCTTCACCACCTTC for gapdh, CCCTGCAAGTGAAGATGAAA and TTCAAGAACTGCGATTCTGG for MuSK, and CATCGAGTGGATCATCATTGAC and CGGCGGATGATAAGGTAGAA for AChR δ. Primer pairs were located in different exons to avoid amplification from contaminating genomic DNA.
Results
Neuronal neuregulin-1 is not required to cluster synaptic AChRs
Previously, we showed that the pattern of AChR gene expression is normal in embryos lacking neuronal Nrg-1 (Yang et al., 2001). Because our studies did not provide quantitative data on AChR RNA or protein expression, it remained possible that AChRs were clustered at a reduced density at neuromuscular synapses in neuronal nrg-1 mutant mice. We therefore inactivated neuronal Nrg-1 by crossing nrg-1 mutant mice with isl1cre mice, which express Cre recombinase in sensory and motor neurons (Srinivas et al., 2001). We labeled AChRs in diaphragm muscle from E18.5 isl1cre/+; nrg-1f/- embryos and control littermates with Alexa-594-α-Bgt and quantitated the density of AChRs at synaptic sites (Fig. 1) (see Materials and Methods). We found no significant difference in the density or total number of AChRs at synaptic sites in control mice and mice lacking neuronal Nrg-1 (density, 98 ± 3.6% of control, p > 0.5; total levels, 100 ± 10.7% of control, p > 0.5) (Fig. 1C). Similar results were obtained for gastrocnemius muscle (density, 108 ± 6.5% of control, p > 0.5; total levels, 106 ± 8.1% of control, p > 0.5; n = 3 for control; n = 2 for mutant). These data demonstrate that neuronal Nrg-1 is not only dispensable for selectively expressing AChR genes in the synaptic region of muscle but also for expressing AChR protein at normal density at synaptic sites.
Quantitation of Cre-mediated deletion of loxP-flanked sequences in muscle
Previous studies have shown that Nrg-1 is expressed by skeletal muscle as well as by motor neurons. Thus, we considered the possibility that muscle-derived, rather than neuronal, Nrg-1 is necessary to express AChR genes selectively in the synaptic region of muscle and to cluster AChRs at synaptic sites. To inactivate muscle-derived Nrg-1, we generated mice carrying a HSA::cre transgene and null and loxP-flanked alleles of nrg-1 (HSA::cre; nrg-1f/-). HSA::cre mice express Cre recombinase selectively in somites as early as E9.5, and by P0, Cre-mediated inactivation of loxP-flanked alleles in skeletal muscle has been described as efficient and uniform among muscles (Miniou et al., 1999). To quantitate how effectively loxP-flanked sequences are deleted in skeletal muscle of HSA::cre mice, we crossed HSA::cre mice with Z/AP reporter mice (Lobe et al., 1999). Because Z/AP reporter mice contain a lacZ cassette that is flanked by loxP sites, Cre-mediated recombination deletes lacZ, inactivating β-gal expression. We visualized β-gal expression by staining sections of muscle with X-gal. In Z/AP mice, β-gal is expressed in multiple cell types within skeletal muscle, including myofibers (Fig. 2A). In muscles from HSA::cre; Z/AP mice, stained for 1 h, β-gal staining is essentially absent from myofibers (Fig. 2B); after a 10 h reaction, interstitial cells are intensely stained (Fig. 2C), and diffusion of this stain may contribute to product accumulation in myofibers at later time points.
We quantitated β-gal expression in Z/AP and HSA::cre; Z/AP mice by staining cross-sections of muscle from E18.5 embryos with X-gal and measuring the rate of product accumulation over time (Fig. 2D). We defined the average β-gal activity in myofibers from Z/AP mice as 100% and found that β-gal activity in HSA::cre; Z/AP mice was reduced by 95% in gastrocnemius muscles (95.2 and 95.4% in two animals), 97% in diaphragm (97.2 and 96.0% in two animals), and 96% in intercostal muscles (96.4 and 96.3% in two animals) (Fig. 2E). Thus, the HSA::cre transgene efficiently deletes loxP-flanked sequences in skeletal muscle.
Muscle-derived neuregulin-1 is not required to cluster AChRs at synaptic sites during embryogenesis
To inactivate muscle-derived Nrg-1, we generated HSA::cre; nrg-1f/- mice. At E18.5, 1 d before birth, HSA::cre; nrg-1f/- embryos were recovered at the expected Mendelian frequency. To study presynaptic and postsynaptic differentiation, we stained whole mounts of diaphragm muscle with probes that allowed us to visualize motor axons, nerve terminals, muscle fibers, and AChRs (see Materials and Methods). In nrg-1f/- embryos, like in wild-type embryos, the main intramuscular nerve is located in the central region of the diaphragm and oriented perpendicular to the muscle fibers (Fig. 3A); nerve terminals innervate muscle fibers adjacent to the main nerve trunk, and AChRs are concentrated at these synaptic contacts (Fig. 3A, C). In E18.5 HSA::cre; nrg-1f/- embryos, the main intramuscular nerve is properly positioned, and motor axons innervate muscle fibers of normal arrangement, size, and structure (Fig. 3B, D). Moreover, the distribution, size, and shape of synaptic AChR clusters appear normal (Fig. 3). These findings indicate that expression of Nrg-1 in skeletal muscle is not essential for the development of muscle fibers, growth of motor axons to muscle, or formation of synapses.
Because these findings do not provide quantitative data on the level of AChR protein expression, we could not exclude the possibility that Nrg-1 is required to cluster AChRs at their normal density at neuromuscular synapses. Therefore, we measured synaptic AChR protein expression by quantitating the amount of Alexa594-α-Bgt bound to synaptic AChRs in diaphragm muscle (Fig. 3E). We found no significant difference in the density or total number of AChRs at synapses in HSA::cre; nrg-1f/- and control mice (density, 98 ± 3.6% of control, p > 0.5; total levels, 90 ± 5.4% of control, p > 0.1) (Fig. 3E) [similar results were obtained for gastrocnemius muscle (density, 103 ± 7.1% of control, p > 0.5; total levels, 94 ± 3.6% of control, p > 0.2; n = 3 for control; n = 5 for mutant)], indicating that expression of synaptic AChRs does not depend on muscle-derived Nrg-1.
Muscle-derived neuregulin-1 is not required for postsynaptic differentiation in postnatal mice
Neuronal Nrg-1 is required for survival of Schwann cells. In the absence of Schwann cells, motor neurons are generated, extend axons to muscle, and form neuromuscular synapses, but these motor neurons die shortly before birth. Thus, in the absence of neuronal Nrg-1, mice lack innervation and die at birth (Yang et al., 2001). Mice lacking muscle-derived Nrg-1, however, are born at the expected Mendelian frequency and are indistinguishable from control mice in size and weight (at P21; nrg-1 mutant, 5.19 ± 0.12 g, n = 4; control, 5.55 ± 0.46 g, n = 3). To determine whether muscle-derived Nrg-1 regulates maturation or maintenance of neuromuscular synapses postnatally, we visualized motor neurons, muscle fibers, and AChRs in whole mounts of diaphragm muscles from P21 nrg-1f/- and HSA::cre; nrg-1f/- mice. We found that the size and shape of synaptic AChR clusters are similar in HSA::cre; nrg-1f/- and nrg-1f/- control mice (Fig. 4A, B). Likewise, the position of motor axons and the shape and size of nerve terminals appear normal in HSA::cre; nrg-1f/- mice (Fig. 4A, B). Thus, in the absence of muscle-derived Nrg-1, neuromuscular synapses are morphologically indistinguishable from wild-type synapses.
To determine whether muscle-derived Nrg-1 is required to maintain AChR expression postnatally, we measured the density and number of synaptic AChRs in P21 mice lacking muscle-derived Nrg-1 and in control littermates. We found that synaptic AChR density and number are indistinguishable in control and mutant mice (density, 102 ± 5.9% of control, p > 0.5; total levels, 94 ± 9.6% of control, p > 0.5) (Fig. 4C). Thus, neuromuscular synapses develop and contain normal levels of AChRs independent of Nrg-1 expression from skeletal muscle fibers.
Because mice lacking muscle-derived Nrg-1 survive past birth, they provide an opportunity to study the potential role of Nrg-1 in switching from the embryonic AChR γ subunit to the adult AChR ϵ subunit. We examined the expression pattern of the AChR ϵ-subunit gene in intercostal muscles of P21 HSA::cre; nrg-1f/- mice by in situ hybridization and found that AChR ϵ-subunit mRNA is concentrated in the central region of muscle from mutant mice, like control littermates (Fig. 4D, E). Similar results were obtained for diaphragm muscle (data not shown). These results indicate that muscle-derived Nrg-1 is dispensable for activating AChR ϵ-subunit transcription in synaptic nuclei postnatally.
Synapse-specific transcription and postsynaptic differentiation in mice lacking both neuronal- and muscle-derived neuregulin-1
Postsynaptic differentiation is normal in mice lacking either neuronal- or muscle-derived Nrg-1. These findings raise the possibility that neuronal- and muscle-derived Nrg-1 have redundant roles in neuromuscular synapse formation. We therefore generated mice carrying both isl1cre and HSA::cre genes and null and loxP-flanked alleles of nrg-1 and examined presynaptic and postsynaptic differentiation, including the pattern and level of AChR gene expression and the density of synaptic AChRs.
We examined the pattern of AChR gene expression in inter-costal muscles of HSA::cre; isl1cre/+; nrg-1f/- E18.5 embryos by in situ hybridization and found that AChR α-subunit and AChR δ-subunit mRNAs are patterned normally in muscle from the doubly, conditional mutant mice (Fig. 5A-D). Utrophin and MuSK genes, like AChR genes, are expressed selectively by synaptic nuclei and respond to Nrg-1 in vitro, raising the possibility that synaptic expression of these genes may require Nrg-1. We therefore examined their expression pattern in mice lacking muscle- and neuronally derived Nrg-1 and found that MuSK and Utrn mRNAs are patterned normally in HSA::cre; isl1cre/+; nrg-1f/- embryos (Fig. 5E-H). These results indicate that the pattern of synapse-specific gene expression does not depend on expression of Nrg-1 by motor neurons or muscle fibers.
To determine whether Nrg-1 regulates the level of AChR or MuSK gene expression in muscle, we measured MuSK and AChR δ subunit mRNA levels in gastrocnemius muscles from E18.5 HSA::cre; isl1cre/+; nrg-1f/- embryos by quantitative RT-PCR (Fig. 5I) (see Materials and Methods). We found that MuSK and AChR δ expression levels are similar in control and mutant mice (MuSK, 92 ± 4.3% of control, p > 0.1; AChR δ, 103 ± 7.1% of control, p > 0.5). Thus, the expression level of synapse-specific genes is not dependent on motor neuron- or muscle-derived Nrg-1.
We studied additional aspects of presynaptic and postsynaptic differentiation in whole-mount preparations of diaphragm muscles from HSA::cre; isl1cre/+; nrg-1f/- embryos (Fig. 6). As expected for mice lacking neuronal Nrg-1, motor innervation is absent by E18.5 in embryos lacking both neuronal- and muscle-derived Nrg-1, because of the absence of Schwann cells, but AChRs remain clustered at synaptic sites, and the shape of AChR clusters in these mutant mice appears normal (Fig. 6A, B). We quantitated the number and density of synaptic AChRs in HSA::cre; isl1cre/+; nrg-1f/- embryos and found that the number but not the density of synaptic AChRs is modestly, but significantly, reduced (∼20%) in both gastrocnemius and diaphragm muscles of mice lacking neuronal- and muscle-derived Nrg-1 (gastrocnemius: AChR number, 71 ± 6.4% of control, p < 0.05; AChR density, 98 ± 5.8% of control, p > 0.5; n = 3 for control; n = 4 for mutant; diaphragm: AChR number, 82 ± 5.4% of control, p < 0.01; AChR density, 92 ± 2.5% of control, p < 0.02; n = 7 for control; n = 8 for mutant) (Fig. 6C). Because the total number of synaptic AChRs is a reflection of AChR density and synaptic size, these data indicate that synaptic size is reduced in mice lacking both neuronal- and muscle-derived Nrg-1. Because the number and density of synaptic AChRs is normal in mice lacking either neuronal-(Fig. 1C) or muscle-derived (Fig. 3E) Nrg-1, these results indicate that neuronal and muscle-derived Nrg-1 have a redundant, although modest, role in regulating AChR number at neuromuscular synapses.
Discussion
AChR genes are transcribed at a higher rate in synaptic than extrasynaptic nuclei of muscle fibers, and this expression pattern contributes to the accumulation of AChRs in the postsynaptic membrane. Prevailing views of neuromuscular synapse formation suggest that Nrg-1 is a key signal for synapse-specific gene expression (Falls et al., 1993; Sandrock et al., 1997; Buonanno and Fischbach, 2001; Schaeffer et al., 2001). We conditionally inactivated Nrg-1 in motor neurons and muscle fibers, the two cellular sources of Nrg-1 at the neuromuscular synapse, and found that the pattern of synapse-specific transcription and the expression level of synaptic genes are normal in these mutant embryos. In mice lacking muscle-derived Nrg-1, synapses develop and mature normally, assuming a pretzel-like shape, and contain normal levels of synaptic AChRs. In the absence of motor neuron- and muscle-derived Nrg-1, however, the total number of synaptic AChRs is modestly reduced, indicating that neuronal- and muscle-derived Nrg-1 have a redundant, although minor, role in regulating AChR expression. Our results therefore provide strong evidence against an essential role for Nrg-1 in neuromuscular synapse formation and synapse-specific transcription during development. In addition, our findings indicate that muscle-derived Nrg-1 is dispensable for synapse-specific transcription in postnatal mice. Because neuronal nrg-1 mutant mice die at birth, however, our experiments do not exclude the possibility that neuronal Nrg-1 has a role in synapse-specific transcription postnatally.
We used isl1cre mice to conditionally inactivate Nrg-1 in motor and sensory neurons. Isl1cre/+; nrg-1f/- mice phenocopy mice lacking Nrg-1/ErbB signaling in Schwann cells (Riethmacher et al., 1997; Morris et al., 1999; Woldeyesus et al., 1999; Yang et al., 2001), indicating that neuronal Nrg-1 is efficiently deleted in motor and sensory neurons of these conditionally mutant mice. We used HSA::cre mice to inactivate Nrg-1 in skeletal myofibers and demonstrated that HSA::cre mediates efficient (>95%) deletion of a loxP-flanked lacZ expression cassette. Indeed, it is likely that inactivation is even more efficient, because some of the X-gal stain in myofibers likely arises from β-gal expression in interstitial cells and diffusion of the X-gal reaction product to nearby myofibers (Fig. 2C).
Previously, we showed that Nrg-2 can activate AChR gene expression in muscle cells expressing ErbB4 and ErbB2 (Rimer et al., 2004), and these data therefore raised the possibility that Nrg-2 might substitute for Nrg-1 in regulating AChR expression. Nrg-2, however, is expressed by motor neurons and terminal Schwann cells but not by muscle, yet AChR expression appears normal in neuronal nrg-1 mutant mice, which lack Schwann cells and ultimately motor neurons. Thus, these data are inconsistent with the idea that Nrg-2 substitutes for Nrg-1 during development and is responsible for the normal pattern and level of AChR expression in neuronal nrg-1 mutant mice.
Consistent with our findings, synapse-specific gene expression appears normal in mice lacking Nrg-1 receptors, ErbB4 and ErbB2, in skeletal muscle (Escher et al., 2005). Because Agrin and MuSK, but not Nrg-1, are essential for synapse-specific transcription, our data support the idea that Agrin/MuSK signaling regulates synapse-specific transcription directly without requiring Nrg-1 signaling.
Footnotes
This work was supported by grants from the National Institutes of Health to S.J.B. We thank Judith Melki and Kevin Campbell for HSA::cre mice; Christopher William, Silvia Arber, and Tom Jessell for Isl1cre mice; Carmen Birchmeier for nrg-1+/- and nrg-1f/+ mice; Jihua Fan for expert technical assistance; and Moses Chao and Matthew Friese for thoughtful comments on this manuscript.
Correspondence should be addressed to Steven J. Burden, Molecular Neurobiology Program, New York University Medical Center, 540 First Avenue, New York, NY 10016. E-mail: burden{at}saturn.med.nyu.edu.
Copyright © 2006 Society for Neuroscience 0270-6474/06/260655-07$15.00/0